Melt curves

 

Figure 1: qPCR melt curves used for sexing mice. Genomic DNA was extracted using prepGEM Tissue from the tail tips of 20 mice.  The sex of a mouse can be determined by a PCR method developed by Clapcote and Roder (2005). qPCR was performed using primers flanking differently sized in the introns of two homologous X and Y linked genes, Jarid1c and Jarid1d. Both loci can be ampli- fied using a single primer pair to generate amplicons of 331 and 302 bp. 


Tissue plots

 

Figure 2: qPCR traces of genomic and mitochondrial genes amplified from beef fat and lean beef. Blue and Green: replicate PCRs from the ZyGEM extracted samples. Black: Positive control DNA. Primers:

MT16SF1 ACCCCGCCTGTTTACCAA
MT16SR4 CTGATCCAACATCGAGGTCG
BOVGAPF1 CTGGCAAAGTGGACATCGTC
BOVGAPF2 TCCATTGATGACGAGCTTCC

prepGEM HeLa

Figure 3: Dilution series of HeLa cells extracted with prepGEM Tissue. qPCR amplification was performed using GAPDH-specific primers. The numbers on the left of the chart indicated the approximate cell numbers in the qPCR. The closed tube method, makes it ideal for extracting DNA from low cell numbers.

Sample Preparation

All manipulations should be performed in a clean room or a PCR hood. Use only certified DNA-free tubes and reagents and wash surfaces likely to come into contact with the samples in 0.05% hypochlorite bleach. Rinse thoroughly with DNA-free water.

 Method

Tissue workflow

1. To a thin-walled PCR tube add:

    • 89 µl DNA-free water
    • 10 µl of 10x buffer GOLD
    • 1 µl prepGEM™

    Add your sample as follows

Tissue Type Procedure

Fat, muscle, organs

Cut the tissue into cubes of approximately 1.5 mm3. Mash the sample with the side of the scalpel under the liquid. Mix well

Rat tail

Clip the 5 mm from the end of the mouse tail and place in the liquid. Crushing the sample first will increase yields.

Fish fin punch,

Use approximately 4 mm2 of a fish tail or fin. Place in the solution.

Hair follicle

Cut the shaft 5 mm above the follicle and place in the solution.

Tissue culture /
dispersed cells

The method has linear yields for 1 - 100,000 cells. For dilute cells, sediment first and remove the liquid supernatant. Add the ZyGEM reagents to the pellet.

 

2. Incubate at 75°C for 15 minutes (solid tissue) 5 minutes (dispersed cells).

3. Incubate at 95°C for 5 minutes. 

A thermal cycler can be used for these steps

4. Aspirate the extract (contains the DNA) away from the tissue.

Do not centrifuge above 5000 r.c.f. The high molecular weight gDNA will sediment at higher speeds.

 


Technical Tips

  • The prepGEM Tissue procedure can be automated using most liquid handling robots.
  • prepGEM Tissue is a preparative method for DNA extraction - it is not a purification protocol.  Its purpose is to lyse cells and to strip the DNA of nucleoproteins. The formulation creates DNA that can be used for SNiPs, STRs, quantitative, multiplex and routine PCR applications. 
  • For accurate yield assessment, a qPCR is recommended. The DNA produced by prepGEM is approximately 90% single-stranded. If standard fluorescent chelating dyes are to be used for quantification, then this factor should be taken into consideration.
  • As with any preparative method for nucleic acid extraction, for best results prepare and manage samples at 4ºC, or on ice, before and after extraction.
  • When storing the sample after extraction, aspirate the supernatant from the precipitated residue and store separately.
  • prepGEM is stable for 30 days at 4º C, for longer-term storage prepGEM should be stored at -20ºC.
  • For long-term storage of the extracted DNA, add TE buffer to 1x and store at -20°C.

Downloadable PDF files

 

 

 If you need any advice, please Contact us